The Clinical Comparison of Intraosseous and Intravenous Anesthesia (Thiopental-Na) in Pigeon | ||
| Iranian Journal of Veterinary Medicine | ||
| مقاله 7، دوره 13، شماره 4، زمستان 2019، صفحه 401-409 اصل مقاله (719.68 K) | ||
| نوع مقاله: Infectious agents- Diseases | ||
| شناسه دیجیتال (DOI): 10.22059/ijvm.2019.269704.1004942 | ||
| نویسندگان | ||
| Mohammad Reza Aghchelou* 1؛ Samane Bakhshi2؛ Dariush Saadati3 | ||
| 1Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Zabol, Zabol, Iran | ||
| 2Graduated from the Faculty of Veterinary Medicine, University of Zabol, Zabol, Iran. | ||
| 3Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, University of Zabol, Zabol, Iran | ||
| چکیده | ||
| Background: Intraosseous injection is a way to administration of drugs. Objective: The clinical comparison of intraosseous and intravenous injection of Thiopental-Na. Methods: First all birds (Twenty six healthy pigeons) were split out into two groups randomly. Group A received 20 mg kg-1 Thiopental-Na by intraosseous route and group B intravenous route. After one week that needs for washing out of drug, group A received 20 mg kg-1 Thiopental-Na by intravenous route and group B intraosseous route. The respiratory rate (fR), heart rate (HR) and cloacal temperature (T) were measured before (0 minute) and 1, 5, 10, 20 and 30 minutes after anesthetic drug administration. Reaction to injection, number of efforts for injection, duration to onset the anesthesia and different scores of anesthesia were checked. Returning from anesthesia in two groups was written out and compared. Results: Statistical assessment showed anesthesia onset in the method of intravenous injection was significantly less than the method of intraosseous injection (p=0.003), and the fR in two groups was different in 1 minute after drug administration (P=0.036). There was not statistically difference in other minutes for fR, HR and T in two groups (P >0.05). Statistical analysis showed that there were no significant differences in terms of number of efforts for anaesthetizing as well as anesthesia stage in both methods in different minutes (p>0.05). Also no significant alterations were recorded for recovery time for both groups. There was not any visible lameness or pain for intraosseous route after recovery. Conclusions: Intraosseous anesthesia injection in birds is a practicable and fast procedure and comparable with intravenous route. | ||
| کلیدواژهها | ||
| anesthesia؛ intraosseous injection؛ intravenous injection؛ Thiopental-Na؛ pigeon | ||
| اصل مقاله | ||
IntroductionSurfactant is synthesized by pneumocyte type II cells in late months of pregnancy, stored in intracellular lamellar inclusion bodies, and released to the alveoli spaces (Bissinger & Carlson, 2006; Frerking, Gün- ther, Seeger, & Pison, 2001; Paramothayan, 2018). Lung surfactant components includ- ing phospholipids, neutral lipids, and pro- teins line the mammalian lung and prevent atelectasis by reducing the surface tension at the air-alveolar interface (Notter, Wang, Egan, & Holm, 2002). There are several studies that mentioned exogenous lung sur- factant can be used for the treatment of re- spiratory disorders (Baer, Souza, Pimentel, & Veldhuizen, 2019; Cai et al., 2011; David- son et al., 2006; Han & Mallampalli, 2015), especially neonatal respiratory distress syn- drome (Soll & Özek, 2009). The methods of obtaining natural surfactants differ from each other in two ways: extraction from BAL and water–salt extraction of minced lung. T and B cells related cytokines and chemo- kines in lung, may possibly play a role in disease progression or healing (Akdis et al., 2016). IL-6 and IL-1-β, tend to promote fi- bro-proliferation, asthma and allergy (Akdis et al., 2016; Rincon & Irvin, 2012), where- as IFN-γ, TGF-β and IL-10 play a key role in healing (Akdis et al., 2016; Cypel et al., 2009; Dockstader, 2016; Pizzutto, Upham, Yerkovich, & Chang, 2015), In patho-physiological conditions of lungs, production and release of IL-6 and IL1-β at high levels lead to development of disease. Among different pulmonary diseas- es, these cytokines are implicated in asthma, chronic bronchitis, chronic obstructive pul- monary disease (COPD), acute lung injury (Ramos‐Payán et al.) and acute respirato- ry distress syndrome (ARDS), which can
be ameliorated by using anti IL-1 and IL-6 drugs (Banchereau, 1994; Tanaka, Naraza- ki, & Kishimoto, 2016; Wispe et al., 1990; Zhang et al., 2015). Thus, pharmacological agents that can either suppress production of these cytokines or elevate modulatory may have potential therapeutic value against vari- ous respiratory diseases (Wispe et al., 1990). Calf lung surfactants extract (CLSE) has been proven to be avaluable drug candidate for the treatment of the infant respiratory dis- tress syndrome (RDS) and other respiratory disorders. However, effect of this surfactant on cytokines pattern is still unknown. In this study, calf minced lung surfactant extract’s (CLSE) effect on cytokines profile (IL-1β, IL-6, IL-10, IFN-γ and TGF-β) of healthy rabbits was evaluated to find possible chang- es in trend of cytokines release, which may have potential therapeutic value against re- spiratory diseases. Materials and MethodsCalf Lung Surfactant IsolationCalf lung surfactant extract (CLSE) was obtained by water-salt extraction of freshly slaughtered calves’ isolated minced lungs. Extracted fluids from the minced lungs were combined and debris was removed by cen- trifugation (Sigma, 3-30 K) at 1200×g for 15 min. Collected supernatant fluids were centrifuged at 20000×g for 30 min, and the obtained pellets were extracted by modified Bligh and Dyer (Bligh & Dyer, 1959). The or- ganic phase was separated and concentrated using rotary evaporator for 30 min (IKA Co, rv10 digital). As a result, neutral lipids and cholesterol are removed from concentrated lipid extract by cold acetone precipitation. Briefly, cold acetone (-20 °C) was added to the extracted samples, vortex and incubated
overnight at -20 °C. It was formulated for the active pharmaceutical ingredients (API) by adding some DPPC and palmitic acid as ex- cipients. Finally, a suspension was prepared by adding NaCl 0.9 %. The amount of en- dotoxin concentration in the finish product was measured by quality method (gel clot). The surface tension-reducing activity in these samples was then assessed using pro- file analysis tensiometer (PAT1, Sinterface Technology, Germany). The different phospholipids classes of the formulated lung surfactant were determined by Hydrophilic Interaction Liquid Chroma- tography Coupled to Electrospray Ioniza- tion−Tandem Mass Spectrometry (HILIC- HPLC-ESI-MS/MS) by negative-ion mode and positive–ion mode. The formulated sample (concentration of the selected sam- ple: 1 mg/mL) was injected to the column containing the mobile phase acetonitrile (A) and ammonium acetate 5mM (B). AnimalTen healthy male New Zealand white rab- bits (Oryctolagus cuniculus), 2.5-3 kg body weight each were purchased from the Ani- mal Sciences Laboratory of Pasteur Institute of Iran. Each rabbit was kept in separated standard cage with temperature 18-22 ⁰C, relative humidity 45-55%, 12-hour light, and 12-hour dark fed standard diet with ad libi- tum water intake. The health of selected rabbits was ap- proved by clinical examinations, hematolo- gy evaluation and radiology in two positions (lateral and antero-posterior). In addition, they were kept under adaptation period for 48 h prior to commencement of the proce- dure. Ethics StatementAll experimental procedures involving animals were approved by the Ethics Com- mittee of Faculty of Veterinary Medicine, University of Tehran and ethics aspect of the use of animals (reduction the used animals, refinement and the rehabilitation of housed animals) in present research was monitored by ethics committee. All methods in this study have been monitored and approved by Faculty of Veterinary Medicine, University of Tehran, Iran. In Vitro and in Vivo Experimental Process For in vivo, five rabbits were anesthetized with Xylazine 2% (5 mg/kg, Holland Inter- chemic Co) plus Ketamine (35 mg/kg, Trittau Co., Germany) via intramuscular injection to minimize pain, suffering and distress during procedure, then the tracheal tube was in- serted into trachea. Following confirmation of the positioning by checking the end tidal CO2 measurement, broncho alveolar lavage catheter was inserted via tracheal tube, and the surfactant solution (4 ml/ kg BW) was infused into the lungs (Mokhber Dezfouli, Eftekhari, Heidari Sureshjani, Dehghan, & Dousti, 2017). Blood samples were collected to isolate PBMC as described elsewhere (Hartmann, Emnéus, Wolff, & Jungersen, 2016). Then IL-10, IL-6, IFN-γ, TGF-β and IL-1β lev- els at 0h (before infusion of the surfactant) and for the following 24, 48, 72 h, 7 days, 14 days and 30 days after surfactant administra- tion were evaluated. In vitro evaluation: four different formu- lated surfactant concentrations (12.5, 25, 50 and 100mg phospholipid/ml) were added to PBMC cultures obtained from five rabbits (untreated with surfactant). After 24 h incu- bation at 37 oC, contents of the wells were centrifuged at 14000 rpm and 4 oC. Super- natants were collected to evaluate cytokines levels, and precipitated cells were collected for cytokines genes expression assessment
from both in vivo and in vitro group. Cytokines AssayCell culture supernatants were harvested and analyzed for IL-10, IL-6, IFN-γ, TGF-β and IL-1-β cytokines by ELISA techniques with commercially available kits (My-Bio Source, Inc). Gene Expression AssayRNA was extracted from the isolated cells followed by the RNX-plus Cinna Gen kit (Tehran, Iran). The reverse transcription process was conducted by Cinna-Gen First Strand cDNA synthesis kit using random hexamer primers (Tehran, Iran). Primer design was set up by ALLELE ID program. Then, primers were verified by NCBI BLAST NUCLEOTED. β–ACTIN was used as housekeeping gene. Finally, Real-Time PCR was used for gene expression analysis and cytokine quantifica-
Table 1. Primers design was set up by ALLELE ID program
Gene Sequence of Primer
F: CCTCGCTCTCCACCTTCC
β – actin( References gene) R: TGCCAATCTCGTCTCGTTTC
IL-1 beta F:TTGAAGAAGAACCCGTCCTCTG R:CTCATACGTGCCAGACAACACC
IL-10
IFN-γ
TGF -beta
IL-6 F: GAGAACCACAGTCCAGCCAT R: CATGGCTTTGTAGACGCCTT F: TTCTTCAGCCTCACTCTCTCC R: TGTTGTCACTCTCCTCTTTCC F:CAGTGGAAAGACCCCACATCTC R:GACGCAGGCAGCAATTATCC F: CTACCGCTTTCCCCACTTCAG R:TCCTCAGCTCCTTGATGGTCTC
Statistical AnalysisThe data were analyzed with repeated mea- sures ANOVA using SPSS version 16.0 soft- ware; significance level was considered as P level less than 0.05. To evaluate the effect of drug administration, data were analyzed with Paired t-test and LSD Post Hoc test. To com- pare the gene expression at the level of five percent, t-test was applied. Data were analyzed based on Delta-Delta cT from the device and the REST2009 software. Normalization of data was conducted by b-actin as a references gene R or Efficiency: 1 or 100%. Comparison of the mean of gene expression at the level of five percent by t-test was performed between two varieties at different times.
ResultsQuality Control of Formulated DrugDifferent phospholipids classes based on molecular weight and retention time were determined by HPLC and HILIC-HPLC- ESI-MS/MS, the frequency of each class is mentioned in Table 2 and Fig. 1, 2. Based on obtained results the main isolated and detected phospholipids include phosphati- dylcholine, phosphatidylserine, phosphati- dylethanolamine, phosphatidylinositole and phosphatidylglycerole which were detected based on retention times. The highest amount of isolated phospholipids by HILIC-HPLC- ESI-MS/MS belongs to phosphatidylcholine (42.3 %), which is the main component of natural lung surfactant that can reduce sur- face tension.
Table 2. Different phospholipids classes and percentages based on molecular weight and retention time and determined by HILIC-HPLC-ESI-MS/MS
Phospholipids PG PI PE+ PS LPE PC SM (%) Frequency 3.3% 14.3% 27.2% 3.1% 42.3% 9.7%
Figure 1. Different phospholipids classes based on molecular weight and retention time determined by HPLC.
Figure 2. Different phospholipids classes based on molecular weight and retention time determined by HILIC-HPLC-ESI-MS/MS.
The results from profile analysis tensiom- eter in triplicate runs of the surface tension of samples was recorded 27. 13 ± 1.30 mN/m (Fig. 3), the obtained results of which be- longed to natural surfactant surface tension in lungs. In Vivo and In Vitro Evaluation of Cy- tokines Content in the Supernatant from PBMC Cells Culture The in vivo results indicated that IFN-γ and TGF-β increase at 24, 48 and 72 h com- pared to launch hour (P=0.03and P=0.04). While, IL-6 and IL-1β level started to de- crease over time in response to surfactant (P< 0.05). IL-6 and IL-1β concentrations in this experiment reached the minimum level at 24 h after challenge. However, IL-10 lev- el did not change significantly. The in vitro assessment of these cytokines show IFN-γ, TGF-β and IL-10 increased in 25, 50 and 100mg surfactant concentration in compari- son to 12.5mg (P=0.02, P=0.04 and P=001). While, IL-6 and IL-1β level started to de- crease by increasing surfactant concentration (P<0.05). IL-6 and IL-1β concentrations in this experiment reached the minimum level at 100mg surfactant concentration.
Figure 3. Extracted Surfactant surface tension analyzed by profile analysis tensiometer. Gene Expression of Cytokines Isolated from PBMC The in vivo results showed that the gene expression of IL-6, IL-10 and IL-1β de- creased (0.84 ±0.02 and 1.14 ±0.02) during the time after exposure to the surfactant 30 days after drug administration and reached its minimum expression (0.52 ± 0.02 and 0.46 ± 0.04). The gene expression of IFN-γ and TGF-β increased due to surfactant therapy, reach- ing its maximum expression after 7 days. However, based on the present results, IFN-γ gene expression increased at 24 compared to 0 hour, (P =0.03). There are significant dif- ferences at the level of 5% at 24, 48, 72 h of the study. The in vitro results showed that the gene expression of IFN-γ, TGF-β and IL-10 in- creased in 15, 25, 50 and 100mg surfactant concentration in comparison to 12.5mg (P= 0.04, P =0.03, P=0.04 and P=001). While, IL-6 and IL-1β level started to decrease by increasing surfactant concentration, (P< 0.05). IL-6 and IL-1β gene expression in this experiment reached the minimum level at 100mg surfactant concentration. Figure 4. Trend of cytokines level in the supernatant from PBMCs culture isolated from treated rabbits. CLSE induce PBMCs to enhance IFN-γ (black trend line) and TGF-β (red trend line) secretion at 24, 48 and 72 hours after treatment. IL-1β, IL-6 and IL-10 secretion did not significant change in compare 0 hour.
DiscussionLung encounters a countless number of particles and infectious agents daily, so the immune system should arrange a defense mechanism to determine whether or not to respond. Cytokines are one of the mediators for regulating the immune system (Appel & Jonsson, 2016). In this paper the effect of exogenous surfactant on the content and cytokines gene expression levels in healthy rabbits was evaluated as an appropriate ani- mal model for the respiratory system. Based on obtained results by HILIC- HPLC-ESI-MS/MS analysis on finished product, it became clear that the main component of formulated lung surfactant includes phosphatidylcholine, phosphati- dylserine and phosphatidylethanolamine that can play a crucial role in natural surfactant structure and reduce surface tension in co- operation with hydrophobic surfactant pro- teins (Notter et al., 2002). Moreover, in situ evaluation of extracted lung surfactant, by profile analysis tensiometer method (PAT1, Sinterface Technology, Germany) showed reduction in surface tension, our formulated sample was recorded 27. 13 ± 1.30 mN/m. The surface tension of water which covers glicocalex of alveolar cells is 72 mN/m that was used as control substance and natural surfactant in lungs adsorption on alveolar surface decreases the surface tension to 23 mN/m, which facilitates the work of breath and provides respiratory mechanics (Notter et al., 2002). During severe septic conditions, lung sur- factant may be lost which is related to pro-in- flammatory cytokines activity specially IL- 1β (Mukhopadhyay, Hoidal, & Mukherjee, 2006; Niederman & Fein, 1990). On the other hand, IFN-γ has anti-inflammatory aspect through inhibition of TNF-α and IL- 1β, and administration of anti-IL-1 agents can ameliorate the pathogenesis effects of inflammation cases (Mühl & Pfeilschifter, 2003; Ouyang et al., 2000). Previous results showed that injection of Kinoret® with inhibition effect of IL-1 could consider- ably decrease the inflammation symptoms (Klimek, Sali, Rayavarapu, Van der Meu- len, & Nagaraju, 2016). In the present study, we found that rabbits injected with exogenous lung surfactant had a significant increase at the levels of IFN-γ and TGF-β in immune cells and decrease in IL-1β and IL-6. These findings were cor- related with other previous studies, which confirmed the immune regulation and tissue repairing effect of IFN-γ and TGF-β (Chung, 2001; Sanjabi, Zenewicz, Kamanaka, & Fla- vell, 2009). There are several therapeutic strategies for RDS among which exogenous surfac- tant therapy has good outcomes (Varvarigou et al., 2012). Based on the in vivo previous studies, pro-inflammatory cytokine pro- files increased during initial phase of RDS, causing progression of disease (Hammoud, Raghupathy, Barakat, Eltomi, & Elsori, 2017; Polin & Carlo, 2014). However, these studies did not mention pleiotropic role of IFN-γ and TGF-β as pro-inflammatory and immune regulation cytokines (Fujio et al., 2016; Sanjabi et al., 2009). Additionally, our studies on gene cytokines expression were correlated with their secretion of these cyto- kines during time points and confirmed by effect of synthetic surfactant on immature lamb lung, causing decrease of inflamma- tory cytokines (Sato & Ikegami, 2012). As the previous study shows, IFN-γ stimulated SP-A expression in the H441 cell line, con- firming its stimulatory effects on SP-A syn- thesis (Wispe et al., 1990), and triggered
anti-inflammatory effect of this protein on microbial pathogens (Reid, Clark, & Palani- yar, 2005). However, TGF-β activation plays an im- portant role in lung remodeling after me- chanical ventilation in the acute lung injury induced by acid aspiration, which exogenous lung surfactant can ameliorate acute lung in- jury in adults, based on decreasing IL-1β, IL-6, IL-10 and TGF-β activation (Cabre- ra-Benitez et al., 2014). In addition, exoge- nous surfactant proteins in coordination with phospholipids can stimulate production and release of TNF-α, IL-1β, IL-6, and IL-8 by human type-II cells (Banchereau, 1994). So, there are contradictory results that clear the relationship between CLSE and directing the immune response. CLSE regulates the gene expression and production of cytokines pro- file that can induce anti-inflammatory prop- erties, while in normal conditions they were inflammatory and harmful for lung. This concept came from in vitro study on assess- ment of CLSE concentrations and cytokines change. With increased CLSE concentration, IFN-γ and TGF-β and even IL-10 were in- creased. In conclusion, this study suggests that CLSE increases the level of IFN-γ and TGF-β, and creation of the immune regula- tion response by decreasing IL-1β, IL-6 and IL-10 could contribute as drug candidate to reduce pathology effect of neonates with re- spiratory distress, particularly at the first 24 h of administration, which can be used as auxiliary and protective drug in respiratory inflammation diseases. Research limitationThis study reports CLSE increases the lev- el of TGF-β. There is evidence that reveals TGF-β is responsible for development of remodeling and fibrosis of different organs
(Fernandez & Eickelberg, 2012). It is un- clear whether the use of this drug candidate or continuing use of it can cause fibrosis or not.
AcknowledgmentsThe authors gratefully acknowledge the support provided by the Institute of Biomed- ical Research of Veterinary Medicine, Uni- versity of Tehran and Research and Produc- tion Complex, Pasteur Institute of Iran. Conflict of InterestThe authors declare that there is no con- flict of interest. | ||
| مراجع | ||
|
| ||
|
آمار تعداد مشاهده مقاله: 1,293 تعداد دریافت فایل اصل مقاله: 757 |
||