Detection and Molecular Characterization of Gammacoronavirus in Quail Population in Iran | ||
| Iranian Journal of Veterinary Medicine | ||
| مقاله 3، دوره 13، شماره 3، پاییز 2019، صفحه 251-259 اصل مقاله (536.76 K) | ||
| نوع مقاله: Infectious agents- Diseases | ||
| شناسه دیجیتال (DOI): 10.22059/ijvm.2019.270976.1004949 | ||
| نویسندگان | ||
| Seyed Sina Bagheri1؛ Seyed Mostafa Peighambari* 2؛ Arash Ghalyanchi Langeroudi3 | ||
| 1Department of Avian Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran | ||
| 2Department of Avian Diseases Faculty of Veterinary Medicine University of Tehran Tehran, Iran | ||
| 3Department of Microbiology and immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran | ||
| چکیده | ||
| BACKGROUND: Gammacoronaviruses, which are single-stranded, positive-sense RNA viruses, are responsible for a wide variety of existing and emerging diseases in birds. The Gammacoronaviruses primarily infect avian hosts. OBJECTIVES: This study aimed to investigate the genetic diversity of Gammacoronaviruses in quail population in Iran. METHODS: In the period from 2016 to 2018, samples from 47 quail flocks with or without enteric signs, were collected from four provinces in Iran. RESULTS: Gammacoronavirus was detected in samples of 4 flocks by using RT-PCR and characterized by N gene sequencing. The isolates formed a distinct group from other Gamma- coronaviruses groups. CONCLUSIONS: The finding suggests the existence of a novel Gammacoronavirus circulating in quail farms. The phylogenetic relationship of the isolates concerning different sequences and geographical regions displayed complexity and diversity. The present study is the first detection of Gammacoronavirus in quail farms in Iran. Further studies are required and should include the isolation and experimental studies of Gammacoronaviruses in Iran. | ||
| کلیدواژهها | ||
| Bird؛ gammacoronavirus؛ N gene؛ phylogenetic relationship؛ quail | ||
| اصل مقاله | ||
IntroductionThe majority of emerging infectious dis- eases of poultry are caused by RNA viruses. Their specific characteristics like high rates of mutation, short generation time and large population sizes help these viruses very much in rapid evolution (Jackwood et al., 2012). The Coronaviridae is now divided into two subfamilies as Coronavirinae and Tor- ovirinae. Coronaviruses (CoVs) are envel- oped viruses within the Coronaviridae fam- ily (Jackwood and de Wit, 2013) and based on the genome size and genetic complexity are the largest RNA viruses identified so far. According to the latest update of the Interna- tional Committee for the Taxonomy of Virus- es (ICTV), Coronaviruses (CoVs) are clas- sified into four genera as Alphacoronavirus (αCoV), Betacoronavirus (βCoV), Gamma- coronavirus, and Deltacoronavirus (Adams & Carstens, 2012). Two-thirds of the genome in the 5′ end is occupied by two overlapping open reading frames encoding viral RNA-de- pendent RNA polymerase (RdRp). At the 3′ end, genes encoding the four major structur- al proteins including spike (S), envelope (E), matrix (M), and nucleocapsid (N) along with genes 3 and 5 which encode nonstructural accessory proteins are located (Britton et al., 2006; Liu et al., 2009). Alphacoronaviruses and Betacoronavirus- es have been isolated from several mammal species, including humans, dogs, cats, and cows. However, all known Gammacorona- viruses only infect avian species with some exceptions. Examples are chicken infectious bronchitis virus (IBV), turkey coronavirus (TCoV) and pheasant coronavirus (Jonassen et al., 2005). Meanwhile, infections in several other species including greylag geese, mallard ducks, pigeons (Cavanagh et al., 2002) and quail (Coturnix japonica) ) have been report-
ed, often with different tissue tropism (Torres et al., 2013; Torres et al., 2016). These find- ings together with the isolation of Gamma- coronaviruses from several other avian spe- cies caused the experts to suspect a role for some species like quail as CoV reservoirs and CoV carriers influencing IBV epidemiology. Mutations and recombination in the CoVs genome have resulted in viruses with differ- ent tissue tropism, increased virulence, and increased ability to persist in the chickens. (Jackwood et al., 2012). Gammacoronavirus- es, genetically related to IBV, were detected in healthy galliform and non-galliform avian species. This finding may suggest that wild birds might carry IBV-like viruses asymptom- atically (Hughes et al., 2009) and prompted us to study the surveillance of Gammacoronavi- rus in quail farms. The aims of this study were to detect the presence of Gammacoronavirus in quail pop- ulation in different areas of Iran and prelim- inary molecular characterization of obtained avian Gammacoronaviruses. Materials and MethodsSampling: A total of 884 cloacal/fecal swabs together with kidney, oviduct, respira- tory and intestinal tract samples from 47 quail flocks were collected from November 2016 to June 2018. The sample size of each flock was determined according to the size of that flock. Samples were provided from Yazd, Alborz, Ghazvin, and Tehran provinces. Virus isolation and Propagation: All sam- ples were homogenized, and a 10% (w/v) suspensions were made in PBS. Subsequent- ly, samples were centrifuged at 1500× g for 20 min at 4 ⁰C. The supernatant was used to inoculate fertile specific-pathogen-free (SPF) embryonated chicken eggs. Homogenized tis-
Sina Bagheri et al. Iranian Journal of Veterinary Medicine
sue samples supplemented with 10,000 IU of penicillin, 10,000 IU of streptomycin and 250 IU of amphotericin B were used for this isola- tion. After one hour at room temperature, 200 µl aliquots of the homogenate of each sam- ple was inoculated into the allantoic cavity of five 9 to 11-day-old SPF embryonated chick- en eggs. The inoculated eggs were incubated at 37 ⁰C and candled daily to check embry- onic viability. Two to 3 days post ncubation, the allantoic fluid was harvested and used for subsequent passages. Six serial passages were performed and the allantoic fluid was collect- ed 48–72 h post-inoculation. Three uninocu- lated SPF eggs were also used as controls in each isolation process (Ghalyanchi Langerou- di et al., 2017). RT-PCR: Total RNA was extracted from 250 µl individual or pooled supernatants us- ing the High pure RNA extraction kit (Roche Diagnostics, Germany) according to the man- ufacturer’s instructions. The purity of the ex- tracted RNA was determined by considering the ratio of the readings at 260 and 280 nm. The extracts were stored at -20 ⁰C until fu- ture use. The cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) as recommended by the manufacturer. The assay was standardized using Qiagen RT-PCR kit and master mix recipes were prepared according to the man- ufacturer’s instructions. The assay was per- formed in a final volume of 25 µl containing 2 µl RT-PCR master mix (HotStarTaq DNA polymerase and 4 mM MgCl2), 0.5 µl of RT mix and 400 nM of PCR primer. The target gene for PCR amplification was nucleocap- sid (N) segment of Gammacoronaviruses genome. For N gene, forward (N103F): cct- gatggtaatttccgttggg and reverse (N102R): ac- gcccatccttaataccttcctc primers were used (Loa et al., 2006). Prior to amplification, the RNA was transcribed at 50 ⁰C for 30 min. Then, the process was followed by one cycle of 94 ⁰C for 15 min to activate and inactivate HotStar- Taq DNA polymerase and reverse transcrip- tase, respectively. The thermocycler program included 40 cycles of denaturation at 94 ⁰C for 15 s and annealing at 58 ⁰C for 30 s; and a final extension at 72 ⁰C for 45 s. The PCR products were electrophoresed on 1.5% aga- rose gels in Tris/Borate/EDTA (TBE) buffer, stained with GelRedTM (Biotium, USA), vi- sualized under UV light and photographed. Furthermore, all positive samples were tested by using RT-PCR to detect the UTR gene as previously described (Ghalyanchi Langerou- di et al., 2017). Attempts were also made to amplify the S gene of viruses detected in this study by trying several primers as cited in pre- vious literatures (Seger et al., 2016; Hamadan et al., 2017). Sequence and phylogenetic analysis: The RT-PCR products were purified using the PCR product purification kit (Roche Diagnostics, Germany) according to the manufacturer’s instruction and submitted for automated se- quencing at the Bioneer Company using PCR primers as sequencing primers. The sequenc- es were aligned and analyzed by BioEdit soft- ware ver. 7.0.9.0 (Hall, 1999) and DNASIS MAX 3.0 (Hitachi Solutions America), and compared with selected sequences available in GenBank database. The genetic distances of the aligned sequences were analyzed with MEGA 7.0 using the neighbor-joining meth- od with the maximum-likelihood model (Ku- mar et al., 2016). The sequence data from four virus isolates of the present study were sub- mitted to the GenBank and the following ac- cession numbers were assigned: MK183095, MK183096, MK183097 and MK183098 for UT-BPG1, UT-BPG2, UT-BPG3 and UT- BPG4 virus isolates, respectively.
Figure 1. Phylogenetic tree based on sequences of N gene. The neighbor-joining method was used. Black circles indicate viruses detected in the present study.
ResultsFrom 2016 to 2018, 47 flocks were exam- ined in which 4 (8.5%) positive flocks were found, all located in Tehran province. Accord- ing to the phylogenetic analysis of N gene, the viruses were clustered in a distinct group other than the known Gammacoronaviruses groups (Fig. 1). The similarity of the sequences ob- served in the current study and those of the other Gammacoronaviruses are presented in Table 1. The findings of this study showed the lowest similarity (97.24%) between ACov/ Quail/UT-BPG2/2017 and ACov/Quail/ UT-BPG3/2017; and the highest similarity (100%) between ACov/Quail/UT-BPG3/2018 and ACov/Quail/UT-BPG4/2018. The isolates were most similar to IR-Ur1_09 (87.34%) and IS_1618_07 (88.59%). Besides, the similari- ty to 4/91 vaccine virus varies from 85.74 to 86.64 while it was from 85.16 to 86.47 for H120 vaccine virus. All positive samples were also positive for UTR gene. However, our at- tempts to amplify the S gene of the four virus isolates of this study failed. DiscussionIn this study, Gammacoronavirus was de- tected in 4 flocks of quail, two of which were presented with mild enteritis and depression. The virus was detected in kidney, reproduc- tive tract, and content of intestine. This sug- gests the fecal-oral route as the possible route of transmission similar to chickens (Torres et al., 2013). To our knowledge, there has been no re- cord of vaccination against IBV in any flocks
Table 1. Identity percentage of the N gene nucleotide sequences of Gammacoronaviruses detected from Iran and other Gammacoronaviruses.
of our investigation. The flocks were only vaccinated against Newcastle disease. The current study viruses were phylogenetically distinct from infectious bronchitis virus, and as the phylogenetic analysis results showed, all Gammacoronavirus isolates detected in quails were different from IBV vaccines. In case of the similarity to vaccine strains, our viruses were 85.74-86.64 and 85.16-86.47 percent similar to 4/91 and H120 vaccine strains, respectively. Currently, RT-PCR amplification of the S1 gene followed by nucleotide sequence analy- sis is being used as the molecular typing test to inexpensively detect the genetic type of some viruses in a short period of time. Un- fortunately, all of our attempts to amplify the S gene of viruses detected in this study were unsuccessful despite trying several primers (Seger et al., 2016; Hamadan et al., 2017). Some coronaviruses like infectious bronchi- tis virus grow in allantoic sac of chicken em- bryonated egg, but all of our attempts to iso- late Gammacoronaviruses failed (Jackwood and de Wit, 2013). Therefore, the discovery of new viruses using Next Generation Se- quencing (NGS) technology including DNA and RNA sequencing in recent years might help us to improve our knowledge about Gammacoronaviruses. To our knowledge, the present study is the first detection of Gammacoronavirus in commercial quails in Iran and because of the potential to act as a host reservoir for Gammacoronavirus, with possible trans- mission to chicken, studying infectious bronchitis virus in quails seems necessary. These findings not only reveal a prevalence of Gammacoronaviruses circulating in birds other than chickens but also suggest a po- tential role for spreading viruses. Based on N gene nucleotide sequences, no sample was placed in the same group with previously published sequences of Gamma- coronavirus isolates. While the most similar isolates with 100% similarity were isolates ACov/Quail/UT-BPG3/2018 and ACov/ Quail/UT-BPG4/2018, only 97.24% simi- larity were found between isolates ACov/ Quail/UT-BPG2/2017 and ACov/Quail/ UT-BPG3/2017. This study may provide preliminary information on the molecu- lar epidemiology of Gammacoronavirus in quail population of Iran. Additional Gam- macoronavirus surveillance and full genome sequences using next-generation sequencing would better clarify the characteristics and the origin of Gammacoronavirus isolates ob- tained in this study. These avian Gammacoronaviruses might not cause severe illness in their hosts, hence; it may easily become endemic in avian popu- lation. However, Circella et al. (2007) report- ed the coronavirus associated with an enteric syndrome in a quail farm. It was detected by electron microscopy and RT-PCR in the fe- ces and intestinal content of the dead quails. Their investigation showed that S1 portion of those isolates displayed 16% to 18% amino acid identity with IBV, and 79% to 81% iden- tity with turkey coronavirus. In this study, the quails of two flocks showed severe diarrhea, reduced growth and depression. Isolation and inoculation of quail Gammacoronavirus in an experimental condition will help us to confirm the pathogenicity of these novel vi- ruses in quails. In another study, Torres et al. (2017) detect- ed Gammacoronavirus and Deltacoronavirus in quails and pheasants in Italy. Sequencing of S gene showed that quail’s isolate was related to 793B and the isolate from pheas- ant was related to Mass type. In the present study, we did not try to detect Deltacorona-
Sina Bagheri et al. Iranian Journal of Veterinary Medicine
virus, however: it seems necessary to inves- tigate Deltacoronavirus in quail’s population of Iran. The findings of this study demonstrated that quails are major reservoirs for a wide range of Gammacoronaviruses. Due to in- tensive trading and uncontrolled movement of poultry and people between provinces of Iran, the distribution of Gammacoronavi- rus around poultry farms is highly possible. Constant updating of the data from continu- ing molecular surveillances of avian corona- viruses would complete this strange puzzle and also help us to be prepared for the possi- ble emerging new variants. AcknowledgmentsThis research was funded by a grant (7508007/6/32) from the Research Council of the University of Tehran Conflicts of interestThe author declared no conflict of interest. | ||
| مراجع | ||
|
| ||
|
آمار تعداد مشاهده مقاله: 1,406 تعداد دریافت فایل اصل مقاله: 756 |
||