| تعداد نشریات | 127 |
| تعداد شمارهها | 7,150 |
| تعداد مقالات | 76,911 |
| تعداد مشاهده مقاله | 154,969,243 |
| تعداد دریافت فایل اصل مقاله | 116,941,164 |
Genetic Characterization of Argas persicus From Iran by Sequencing of Mitochondrial Cytochrome Oxidase I (COX1) and 16s rRNA Genes | ||
| Iranian Journal of Veterinary Medicine | ||
| مقاله 5، دوره 13، شماره 1، فروردین 2019، صفحه 45-57 اصل مقاله (5.68 M) | ||
| نوع مقاله: Genetics - Immunology | ||
| شناسه دیجیتال (DOI): 10.22059/ijvm.2019.266128.1004926 | ||
| نویسندگان | ||
| Shahriar Yavari1؛ Sedigheh Nabian* 1؛ Elahe Ebrahimzade Abkooh2؛ Parviz Shayan1؛ Hamidreza Shokrani3 | ||
| 1Department of Parasitology, Iranian Center for Ticks and Tick-borne Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran | ||
| 2Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran | ||
| 3Department of Pathobiology, Faculty of Veterinary Medicine, Lorestan University, Khorramabad, Iran | ||
| چکیده | ||
| Background: Argas persicus has a great importance for health and veterinary, it can transmit many infectious agents such as Borrelia anserina (avian spirochetosis) and Aegyptianella pullorum. Distinguishing Argasidae due to close morphological relationship is difficult. OBJECTIVES: In the present study, we performed molecular analyses based on PCR and sequencing of Amplicon derived from 16S rRNA and COX1 genes of A. persicus specimens in several provinces of Iran. Methods: Out of seventy Argas persicus collected and confirmed morphologically, eight ticks were chosen from five provinces of Iran for gene analysis. Their DNA were extracted and amplificated using primers derived from 16 S ribosomal RNA and COX1 genes using PCR. Then the amplicons were sequenced and analyzed by Chromas software and sequence alignment program (Clustal W). Phylogenetic analysis was also conducted using MEGA ver. 6.06 with a maximum-likelihood method. RESULTS: Sequencing results indicated that all eight samples belonged to A. persicus species. Their nucleotide sequencing revealed that the interspecific sequence differences of both genes (16S rRNA genes and COX1) between our isolates were very infrequent. All isolates from different provinces were conserved across regions except for one isolate that exhibited a difference of only 1 nucleotide. Within Phylogenetic tree, A. persicus formed a clade with A. persicus from other regions of the world (South Arica, Italy, China, and South Australia). CONCLUSIONS: Our findings suggested a very close phylogenetic relationship between A. persicus specimens obtained from different regions of Iran. Keywords: | ||
| کلیدواژهها | ||
| Argas persicus؛ COX1؛ Phylogenetic analysis؛ 16S rRNA | ||
| اصل مقاله | ||
|
Ticks of the genus Argas (Acari, Argasidae) are spread to many parts of the world, probably via poultry hosts (Mehlhorn, 2014; Yu et al., 2015). It has been considered as a parasite of chickens, turkeys, pigeons and other birds (Davari et al., 2017; Kayedi et al., 2016; Pantaleoni et al., 2010). They have a great importance for health and veterinary, which can increase the risk of major direct damages for domestic fowl (turkeys, chickens, Guinea fowls, Helmeted, etc.), (Hoogstraal, 1979; Keirans & Durden, 2001; Koc et al. 2015); Therefore, they attracted a considerable amount of attention due to their potential impact on mentioned birds. Ticks are considered as natural reservoir hosts, which can play an important role in transmission of numerous infectious agents, such as bacteria, viruses and Rickettsia (Hosseini-Vasoukolaei et al., 2014; Orkun et al., 2014), and spirochetes (Parola & Raoult, 2001; Shah et al., 2004). A. persicus, also known as Tick of fowl or poultry but, carriers of the Borrelia anserine (spirochete gallinarum), which causes one of the most serious diseases influencing the poultry production (Bourne, 2013; Aslam et al., 2013; Yu et al., 2015). Furthermore, different types of virus (West Nile virus), (Kayedi et al., 2015) and bacteria, including E.coli, Salmonella sp. (Tavassoli et al., 2015), Proteus sp. (GINSBERG, 2013), Aerobacter, Flavobacterium. can be transmitted by A. persicus (Keshtkar-Jahromi et al., 2013; Shah et al., 2004). Previous studies provided some information about the distribution pattern of these ectoparasites, as well as epidemiology, morphology, transmission of diseases (Ahmed et al., 2007; Chegeni & Tavakoli, 2018; Chitimia et al., 2010; Muñoz-Leal et al., 2018; Rezaei et al., 2016), and less effort has been made in genetic characterization of A. Persicus. In the current study, genetic analyses were performed for providing both a better understanding of the specific characterization of their genetic architecture. A number of studies have reported that Cytochrome oxidase I (COX1) and 16S ribosomal RNA (16S rRNA) genes are capable to provide valuable resources for the molecular phylogeny and genetics of these organisms (Cruickshank, 2002; Dermauw, 2013; Greay et al., 2016; Lu et al., 2013). It seems that there is not any information about genetic characters of Argas genus ticks in Iran. Hence, the current study was performed for the first time based upon COX1 and 16S rRNA genes of specimens obtained from several provinces of Iran. Material and Methods Tick sources: Argas ticks isolates were collected in January 2016 from different geographic locations of Iran including Sanandaj, Kermanshah (Gilan Gharb), Urmia, Lorestan (Poldokhtar), Lorestan (Khoramabad), Kermanshah (Dallaho), Kermanshah (Sarpole Zohab) and Hamedan in May 2016 Sample preparation: Out of seventy Argas persicus collected and confirmed morphologically, eight ticks were chosen from five provinces of Iran for gene analysis. The isolates of A. persicus were confirmed by morphological features based upon use of comprehensive keys and preserved in 70% alcohol; thereafter, samples were transported to the parasitology laboratory, Faculty of Veterinary Medicine University of Tehran. Samples were dried on filter paper and finally homogenized. Genomic DNA was also extracted from different ticks by a DNA extraction kit (MBST, Tehran, Iran), according to the manufacturer’s recommendations with a little change (Shayan et al., 2007). The ticks were carefully crushed using a germ-free pounder for around 10 min. Then, 180μl of lysis buffer was added to the crushed ticks. After shaking and homogenization, 20μl proteinase K (10 mg/ml) was added to the tube, followed by incubation of mixture at 55°C for 10 min and incubated for 24h overnight at 37 °C. Afterward, 360μl binding buffer were added to the tube and thereafter incubated for 10 min at 70°C. In the next step, 270μl ethanol 100% was added to the solution. Then, the solution was vortexed on a mini-vortex mixer and the whole volume was transferred to the MBST-column, followed by centrifugation at 8000×g. Subsequently, the columns were washed twice with 500μl washing-buffer at 8000×g. To eliminate the remaining ethanol from solution, columns were then centrifuged at 12000×g at the end of the extraction protocol. Finally, DNA samples from each isolate were eluted with 60μl elution buffer and immediately stored at −20°C. The extracted DNA was electrophoresed and analyzed on 1.5% agarose in 0.5 % TBE buffer using safe stain and a ultra-violet (UV) transilluminator. The quantity of the extracted DNA was measured by using NanoDrop spectrophotometer. Polymerase chain reaction (PCR) 16 S rRNA and COX1 originated specific primers were applied for confirming all isolates using PCR. The following primers were used: 16S rRNA, 5’-GCTCAATGATTTTTTAAATTGCTGTGG-3’ and 5’-CCGGTCTGAACTCAGATCAAGTA-3’(Black & Piesman, 1994); COX1, 5′-AGCCATTTTACCGCGATGATT-3′ and 5′- GTATTGAAGTTTCGGTTCGGT -3′. In the current study, primers were designed by oligo7 software for COX gene. PCR was performed in a final volume of 50μl, including 100 ng of template DNA, 25 µl Maxima Hot Start PCR Master Mix (2×) (Bio-Rad, United State), 1µl (20µMol) of each primer, and 20 µl of nuclease-free water. The samples were then amplified in a thermo cycler (Bio-Rad, United State). Amplification was performed with a program consisting of one cycle represents initial denaturation at 95 ˚C for 5min, followed by 36 cycles of denaturation at 95 ˚C for 45s, annealing at 55 ˚C for 45s, and extension at (72 ˚C for 45s). Finally, the process was completed by final extension at 72 ˚C for 7 min. PCR amplicons were loaded on 1.5% agarose gel, stained with Simply Blue safe staining (Invitrogen) and visualized by ultraviolet transilluminator (genius, USA). The amplicons were sequenced by Macrogen company (Korea). Sequence and phylogenetic analysis: Nucleotide sequences of 16srRNA and COXI genes from all collected ticks were aligned with each other and other corresponding registered sequences to evaluate their similarities. Multiple consensus sequences were modified using BioEdit sequence alignment editor (DNA Align Editor). Sequences were aligned using the program online Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo). In the present study, partial sequence alignment of 16s rRNA mitochondrial gene was performed with 21 Argas sequences retrieved from GenBank (AY436769.1, AY436769.1, GU355920.1, L34321.1, AF001404, GU451248.1, KR297209.1, KX258880.1, LC209198, KJ465099.1, KJ465101.1, DQ295778.1, KX855210.1, KY705381.1, KY705381.1, KX855207.1, KX855206.1, AY436768.1, GU355921.1 AB819157.1, AF001403.1, KC769587.1, AY436767.1, EU283344.1, L34322.1, AF001401.1 KJ133580.1) and eight sequences obtained in the present study. Phylogenetic analyses (Evolutionary relationships) of A.persicus with other ticks based on 16srRNA nucleotide sequence were conducted based upon the use of the maximum composite likelihood method using MEGA 6.06 version. Branch support was evaluated by bootstrapping over 1000 replications. Sequences of Ornithodoros rostratus (Spain; DQ295780) and Ornithodoros brasiliensis (Brazil; GU198368) were applied as out-group. After there, nucleotide sequences were translated to corresponding peptide sequences (https://web.expasy.org/translate). Furthermore, multiple alignment of obtained peptide sequences of A. persicus in this study with COX1 gene reference sequence (L34321.1) was performed. Results Regarding to the 16S rRNA and COX1 specific primers, sequencing indicated that eight samples belonged to A. persicus groups, where the morphological study confirmed this finding. In addition, generated sequences were assembled and Basic Local Alignment Search Tool (BLAST) was subsequently applied to deduce closest similarities with other Argasid species available in GenBank. PCR amplification of each target gene of 16srRNA and COXI from individual DNA of A.persicus isolates resulted in amplicons of the expected size which were 460 bp and 650 bp in length respectively (Fig. 1, 2). All PCR products (amplicons) exhibited a distinct band. Overall, in a sample set, there was no detectable length difference among different tick species. In comparison, among all examined Argas persicus species sequences, the interspecific sequence differences of both genes (16S rRNA genes and COX1) were found to be very infrequent. The Multiple alignments of all tick isolates at 16s rRNA gene showed only 2 variable nucleotides, the first at position 121(G / A) only in Kermanshah isolate and the second at position 214 (T/C) in all studied isolates in comparison with reference sequence number (L34321) (Fig.3). Sequencing of 16s rRNA was showed A. persicus is homogeneous with the other region of the world Describing sequencing results of COX1 analysis revealed that all isolates from different provinces (Sanandaj, Urmia, Lorestan (Poldokhtar; Khoramabad), Kermanshah (Dallaho), Kermanshah (Sarpol-e Zahab) and Hamedan were conserved across regions except for one isolate identified as Kermanshah isolate (Gilan Gharb) that had variations at one location. This variation is a transition where a purine nucleotide is changed for another purine (T/C) (Fig. 4). Our finding suggested that nucleotide variation has a frequency of 1 percent among A. persicus ticks obtained from Kermanshah (Gilan Gharb) and those from the South Africa (KJ133581.1), Chile (KX258880), Brazil (KX258880.1), Italia (GU451248.1), and U.S.A (L34321.1), Romania (FN394341.1), Australia (AY436770.1), United States (L34321), Egypt (AF001402) and China (KR297209.1). Based on the finding presented herein, the major Iranian host of A. persicus was the domestic fowl and turkeys. On the other hand, low number of infestation was found, in cold areas such as Phylogenetic analysis: Phylogenetic relationships based on 16srRNA clearly displayed A. persicus grouping in a similar clade supported by high bootstrap value for all branchings (Fig. 4). Within Phylogenetic tree, A. persicus formed a clade with A. persicus from other regions of the world (South Arica, Italia, China, and South Australia), (Fig.6). Our analysis revealed that, all subgenus persicargas (Argasidae group) including A. persicus, A. miniatus, and A. walkerae constitute the monophyletic group of Argasinae. Phylogenetic tree suggested that all mitochondrial genomes of the Argasidae family were located in a monophyletic clade and confirmed by high values of posterior probabilities. Discussion A. persicus is globally distributed to tropical and sub-tropical areas of the world (Hoogstraal & Kim, 1985), that is known as a fowl parasite with medical importance. It serves as the vector of avian spirochetosis (Borrelia anserina) and aegyptianellosis (Aegyptianella pullorum), (Khater et al., 2013; Tavassoli et al., 2015)). Additionally, it is involved in spreading West Nile virus (WNV; Flaviviridae), Salmonella pullorum, and Salmonella gallinarum, as well as Rickettsia spp. of the spotted fever group (Tavassoli et al., 2015; Yu et al., 2015).Taxonomic distinguishing of Argasidae ticks (soft ticks) is difficult using macroscopic and microscopic examination ( Ronaghi et al., 2015); thus, molecular-genetic characterization of the Argas ticks is highly recommended, where 16S rRNA and COX1 genes are recognized as appropriate markers to investigate their phylogenetic or evolutionary characteristics (Cruickshank, 2002). For providing better phylogenic findings Black and Piesman (1994) have applied 16S rRNA to examine the phylogeny of tick’s subfamilies (Ixodidae: Argasidae). In a study by Crosbie et al. (1998) a 300-bp portion of the mitochondrial 16S rRNA was used to determination phylogenetic relationships of the Dermacentor species. In accordance with our findings, they suggested that 16S rRNA appear as a suitable marker for use in phylogenetic analysis (Crosbie et al.. 1998). In addition, COXI gene used for this purpose and compared with some the other genes (Chitimia et al., 2010). The finding of our study indicated that the interspecific sequence differences were very rare among A. persicus isolates obtained from dissimilar provinces. In the other same study Petney et al. (2004) revealed a variation of 0.5–1.5% between the three A. persicus ticks from Australia using 16s r RNA gene. Muñoz-Leal et al. (2018) reported an intriguing coincidence between two A. persicus species with vastly distanced geographical distributions as pointed previously by Burger et al. (2014). Another study by Burger et al. (2014) confirmed a close phylogenetic association between A. miniatus from Brazil and A. robertsi from Australia, where two specimens exhibited a difference in just one nucleotide over 400-bp of 16S rRNA region. Some evidence indicated that a very close phylogenetic relationship can be observed among Argas (Persicargas) species even in distant geographic areas. In the present study, domestic fowl was the most frequently host for A. persicus. Mirzaei et al. (2016) and Lafri et al. (2018) described that the fowl tick A. persicus has a perfect adaptation and cohabitation with domestic fowl. In agreement with our study, A. persicus has been reported as a common parasite of poultry (Hoogstraal & Kim, 1985; Lafri et al., 2018). Based on the data presented in our study all obtained isolates from different provinces were conserved across marker regions except one isolate that was completely similar to those from South Africa, Chile, Brazil, Italy, U.S.A, Australia, Egypt and China. Another study noted that the 16S rRNA marker region exhibited a close phylogenetic association (99–100%) between A. persicus from Australia and A. persicus miniatus from Brazil (Muñoz-Leal et al., 2018). There is satisfactory agreement between our results and the findings of Petney et al. in 2004 ,which showed a high similarity (variation of 0.5–1.5%) was found between A. persicus ticks from Australia and those from the United States (Ac: L34321) and Egypt (Ac: AF001402. In the current study, the 16S rRNA marker region demonstrated a close phylogenetic association between our samples and A. persicus of GenBank (L34321). Two sequences showed a difference by only 1 bp; it consists of 2 transitions (point mutation) between the first at position 121(G/T) and the second at position 214 (T/C), while these changes were difference from other regions of the world (Muñoz-Leal et al., 2018; Petney et al., 2004). In the current study, phylogenetic tree demonstrated that all A.persicus groups create a monophyletic group. Our results was consistent with previous studies from different countries, such as Australia , Brazil, Chile and Cuba (Muñoz-Leal et al., 2018), USA (Black & Piesman, 1994) and Netherland (Burger et al., 2014). It should be taken a consideration that morphological characters of Argasidae soft ticks are very similar (Keirans & Durden, 2001; Manzano-Román et al., 2012; Muñoz-Leal et al., 2018). The similarity in genetic and morphological traits of A. persicus isolates render them a significant challenge for resolving phylogenetic links among very closely associated species or within species that has not yet been resolved. Hence, detailed research studies are needed in terms of morphological and genetic characteristics using another gene, as well as other mechanisms underlying phylogenetic relationship. Our findings revealed that these species were highly distributed in tropical areas, when compared with cold areas such as Dalaho in Kermanshah and Urmia. However, Muñoz-Leal mentioned that A. persicus miniatus is distributed in tropical climatic zones, while conversely the distributions of A. persicus overlap in many areas with dry climates (Muñoz-Leal et al., 2018). A high rate of A. persicus distribution was found during spring in the Alashtar county that is in agreement with our study (Davari et al., 2017). We conclude that there are low levels of sequence variation among A. persicus isolates from different provinces of Iran. Furthermore, our findings suggested a very close phylogenetic relationship between our A. persicus specimens and other sequences from other regions of the world. Our research was the first effort to clarify interspecific genetic variability at the mitochondrial DNA (mtDNA) level in Iranian A. persicus using 16srRNA and Cox1 sequences. The results provided that the 16 srRNA and Cox1 sequences could offer a more extensive documentation of their suitable capacity for characterizing genetic architecture and detection of ticks worldwide. Acknowledgments We are appreciative to the Dr. Yaghoubi for his collaboration and Dr Moradi, Mrs. Shahin saidi, Dr Farahi for tick collections. In addition, this research was supported by the Vice-Chancellor for research grant (No.) Faculty of Veterinary Medicine University of Tehran, Iran. Conflicts of interest The author declared no conflict of interest.
| ||
| مراجع | ||
|
Ahmed, J., Alp, H., Aksin, M., Seitzer U. (2007). Current status of ticks in Asia. Parasitol Res. 101(2), 159-162. https://doi.org/10.1007/s00436-007-0696-3 PMID: 17823819 Aslam, B., Hussain, I., Mahmood, M. S., Khan, A. (2013). Preparation and evaluation of Montanide ISA 206 adjuvanted bacterin of Borrelia anserina in laying chickens. J Appl Poult Res, 22(2), 196-203. http://dx.doi.org/ 10.3382/japr.2012-00571 Black, W. C., Piesman, J. (1994). Phylogeny of hard-and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci U S A, 91(21), 10034-10038. http://doi.org/10.1073/pnas.91.21.10034 PMID: 7937832 Burger, T. D., Shao, R., Labruna, M. B., Barker, S. C. (2014). Molecular phylogeny of soft ticks (Ixodida: Argasidae) inferred from mitochondrial genome and nuclear rRNA sequences. Ticks Tick Borne Dis, 5(2), 195-207. https://doi.org/10.1016/j.ttbdis.2013.10.009 PMID: 24378079 Chegeni, A. H., Tavakoli, M. (2018). Aegyptianella pullorum (Rickettsiales: Anaplasmataceae) in tick Argas persicus (Acari: Argasidae) from Iran: a preliminary assessment. Persian J Acarol, 7(3), 307-311. http://dx.doi.org/10.22073/pja.v7i3.37407 Chitimia, L., Lin, R.-Q., Cosoroaba, I., Wu, X.-Y., Song, H.-Q., Yuan, Z.-G. (2010). Genetic characterization of ticks from southwestern Romania by sequences of mitochondrial cox1 and nad5 genes. Exp Appl Acarol, 52(3), 305-311. https://doi.org/10.1007/s10493-010-9365-9 PMID: 20473707 Crosbie, P. R., Boyce, W. M., Rodwell, T. C. (1998). DNA sequence variation in Dermacentor hunteri and estimated phylogenies of Dermacentor spp.(Acari: Ixodidae) in the New World.J Med Entomol, 35(3), 277-288 https://doi.org/10.1093/jmedent/35.3.277 PMID: 9615547 Cruickshank, R. H. (2002). Molecular markers for the phylogenetics of mites and ticks. Syst Appl Acarol, 7(1), 3-14. http://www.bioone.org/doi/full/10.11158/saa.7.1.1 Dantas-Torres, F., Latrofa, M. S., Annoscia, G., Giannelli, A., Parisi, A., Otranto, D. (2013). Morphological and genetic diversity of Rhipicephalus sanguineus sensu lato from the New and Old Worlds. Parasites Vectors, 6(1), 213. https://doi.org/10.1186/1756-3305-6-213 Davari, B., Alam, F. N., Nasirian, H., Nazari, M., Abdigoudarzi, M., Salehzadeh, A. (2017). Seasonal distribution and faunistic of ticks in the Alashtar county (Lorestan Province), Iran. Pan Afr Med J, 27, 284. https://doi: 10.11604 /pamj.2017.27.284.10341 PMID: 29187953 Dermauw, W. (2013). Acari genomics: from phylogenetics to agricultural applications. Ghent University, Blgium. Ginsberg, H.S. (2013). Tick Control. Biology of Ticks, 2, 409. Greay, T. L., Oskam, C. L., Gofton, A. W., Rees, R. L., Ryan, U. M., Irwin, P. J. (2016). A survey of ticks (Acari: Ixodidae) of companion animals in Australia. Parasit Vectors, 9(1), 207. PMID: 27160149 Hoogstraal, H., Kim, K.C. (1985). Tick and mammal coevolution, with emphasis on Haemaphysalis. In: Coevolution of Parasitic Arthropods and Mammals.Kim, K.C. (ed.). Wiley, New York, USA. p. 505–568. Hoogstraal, Harry. (1979). The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. J Med Entomol, 15(4), 307-417. PMID: 113533 Hosseini-Vasoukolaei, N., Oshaghi, M. A., Shayan, P., Vatandoost, H., Babamahmoudi, F., Yaghoobi-E, M.R. (2014). Anaplasma infection in ticks, livestock and human in Ghaemshahr, Mazandaran Province, Iran. J Arthropod Borne Dis, 8(2), j 204. PMID: 26114134 Kayedi, M. H., Chinikar, S., Mostafavi, E., Khakifirouz, S., Jalali, T., Hosseini-Chegeni, A. (2015). Crimean–Congo hemorrhagic fever virus clade iv (Asia 1) in ticks of western Iran. J Med Entomol, 52(5), 1144-1149. https://doi.org/10.1093/jme/tjv081 PMID: 26336221 Kayedi, M. H., Taherian, M. R., Hosseini-Chegeni, A., Chegeni-Sharafi, A., Mokhayeri, H. (2016). The identification of genus, species and distribution of hard and soft ticks collected from livestock and fowl bodies in Aleshtar and Aligodarz counties, Lorestan Province, Iran. Life Sci J, 13(1s), 1-6. Keirans, J. E., Durden, L. A. (2001). Invasion: exotic ticks (Acari: Argasidae, Ixodidae) imported into the United States. A review and new records. J Med Entomol, 38(6), 850-861. https://doi.org/10.1603/0022-2585-38.6.850 PMID: 11761384 Keshtkar-Jahromi, M., Sajadi, M. M., Ansari, H., Mardani, M., Holakouie-Naieni, K. (2013). Crimean–Congo hemorrhagic fever in Iran. Antiviral Res, 100(1), 20-28. https://doi.org/10.1016/j.antiviral.2013.07.007 Khater, H. F., Seddiek, S. A., El-Shorbagy, M. M., Ali, A. M. (2013). Erratum to: The acaricidal efficacy of peracetic acid and deltamethrin against the fowl tick, Argas persicus, infesting laying hens. Parasitol Res, 112(10), 3669-3678. PMID: 23090722 Koc, S., Aydın, L., Cetin, H. (2015). Tick species (Acari: Ixodida) in Antalya City, Turkey: species diversity and seasonal activity. Parasitol Res, 114(7), 2581-2586. https://doi.org/10.1007/s00436-015-4462-7 PMID: 25869959 Lafri, I., Benredjem, W., Neffah-Baaziz, F., Lalout, R., Abdelouahed, K., Gassen, B. (2018). Inventory and update on argasid ticks and associated pathogens in Algeria. New Microbes New Infect, 23, 110-114. https://doi.org/10.1016/j.nmni.2018.02.009 PMID: 29692914 Lu, X., Lin, X.-D., Wang, J.-B., Qin, X.-C., Tian, J.-H., Guo, W.-P. (2013). Molecular survey of hard ticks in endemic areas of tick-borne diseases in China. Ticks Tick Borne Dis, 4(4), 288-296. https://doi.org/10.1016/j.ttbdis.2013.01.003 PMID: 23538111 Manzano-Román, R., Díaz-Martín, V., Fuente, J., Pérez-Sánchez, R. (2012). Soft ticks as pathogen vectors: distribution, surveillance and control. In: Parasitology. Shah, M.M. (ed.). Rijeka, Croatia: In Tech. p. 125–162. Mehlhorn, H. (2014). Argas species, leather or soft ticks. Encyclopedia of Parasitology, 1-4. https://doi.org/10.1007/978-3-642-27769-6_260-2 Mirzaei, M., Ghashghaei, O., Yakhchali, M. (2016). Prevalence of ectoparasites of indigenous chickens from Dalahu region, Kermanshah province, Iran. Turkiye Parazitol Derg, 40(1), 13. Muñoz-Leal, S., Venzal, J. M., Nava, S., Reyes, M., Martins, T. F., Leite, R. C. (2018) The geographic distribution of Argas (Persicargas) miniatus and Argas (Persicargas) persicus (Acari: Argasidae) in America, with morphological and molecular diagnoses from Brazil, Chile and Cuba. Ticks Tick Borne Dis, 9(1), 44-56. https://doi.org/10.1016/j.ttbdis.2017.10.009 Orkun, Ö., Karaer, Z., Çakmak, A., Nalbantoğlu, S. (2014). Spotted fever group rickettsiae in ticks in Turkey. Ticks Tick Borne Dis,5(2), 213-218. https://doi.org/10.1016/j.ttbdis.2012.11.018 PMID: 24355764 Pantaleoni, R., Baratti, M., Barraco, L., Contini, C., Cossu, C., Filippelli, M. (2010). Argas (Persicargas) persicus (Oken, 1818)(Ixodida: Argasidae) in sicily with considerations about its Italian and west-Mediterranean distribution. Parasite, 17(4), 349-355. https://doi.org/10.1051/parasite/2010174349 PMID: 21275242 Parola, P., Raoult, D. (2001). Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis, 32(6), 897-928. https://doi.org/10.1086/319347 PMID: 11247714 Petney, T. N., Andrews, R. H., McDiarmid, L. A., Dixon, B. R. (2004). Argas persicus sensu stricto does occur in Australia. J Parasitol Res, 93(4), 296-299 https://doi.org/10.1007/s00436-004-1141-5 PMID: 15175879 Rezaei, F., Hashemnia, M., Chalechale, A., Seidi, S., Gholizadeh, M. (2016). Prevalence of ectoparasites in free-range backyard chickens, domestic pigeons (Columba livia domestica) and turkeys of Kermanshah province, west of Iran. J Parasit Dis, 40(2), 448-453. https://doi.org/10.1007/s12639-014-0524-5 PMID: 27413319 Ronaghi, H., Nabian, S., Ebrahimzadeh, E., Biranvand, F., Shayan, P. (2015). Molecular characterization of Rhipicephalus (Boophilus) annulatus from Iran by sequences of cytochrome c oxidase subunit I (COI) and the second internal transcribed spacer (ITS2). Iran J Vet Med, 9(2), 117-123. https://doi.org/10.22059/ijvm.2015.54010 Shah, A.H., Khan, M.N., Iqbal, Z., Sajid, M.S. (2004). Tick infestation inpoultry. Int J Agric Biol, 6, 1162–1165. Shayan, P., Borji, H., Eslami, A., Zakeri, S. (2007). Isolation of DNA from a single Helminth using new developed Kit in Iran and its PCR analysis. Iran J Parasitol, 2(2), 34-39. Tavassoli, M., Sabeghi, Z. R., Ghorbanzadeh, B., Shamsi, S., Arjmand, J., Golabi, M. (2015). The underwater survival of adult and larval stages of Argas persicus (Acari: Argasidae). Persian J Acarol, 4(2), 213-220. http://dx.doi.org/10.22073/pja.v4i2.11442 Yu, Z., Wang, H., Wang, T., Sun, W., Yang, X., Liu, J. (2015). Tick-borne pathogens and the vector potential of ticks in China. Parasit Vectors, 8(1), 24. https://doi.org/10.1186/s13071-014-0628-x | ||
|
آمار تعداد مشاهده مقاله: 1,979 تعداد دریافت فایل اصل مقاله: 894 |
||